| Aliases | hsa_circ_0023984 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr11:89133184-89135710:- | ||||
| CircRNA type | . | Gene ID | ENSG00000086991.8 | ||||
| Gene Name | NOX4 | Detection pipeline | . | ||||
| Sample Type | Huvec; Bj; Ag04450 | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_5970 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr11:89133184-89135710 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | SH-SY5Y_D8_exp2;Diencephalon;Lung;Liver_N8;Kidney;Heart;Liver_T3;H9;Liver_T12;AG04450;Cerebellum;PA1;BJ;Liver_T15;Temporal;Stomach;Cortex;Parietal;SH-SY5Y_D4_exp1;Liver_T8;Liver_T7;Thyroid;Occipital;SH-SY5Y_D0_exp1;Forebrain;HUVEC;Hs68;Liver_T20;Liver_T17;Liver_N18;Liver_T22;Liver_T21;Liver_T19 | ||||||||
| Method for Estimation | Ribo-;poly(A)-;RNaseR | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circRNA_100933/hsa_circ_0023984 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr11:89133184-89135710:- | ||||
| CircRNA type | N/A | Gene ID | ENSG00000086991.8 | ||||
| Gene Name | NOX4 | Detection pipeline | N/A | ||||
| Sample Type | Infantile Hemangioma (IH) | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | AATCATCCATTTACCCTCACA | ||||||||
| Reverse Primer | AGAGCTGGTTCGGTTAAGACT | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |