Aliases hsa_circ_0020397 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr10:128768965-128926028:+
CircRNA type . Gene ID ENSG00000150760.8;ENSG00000232935.2;ENSG00000223528.3
Gene Name DOCK1;RP11-223P11.2;RP11-223P11.3 Detection pipeline .
Sample Type Nhek; Hmec; Hepg2; Helas3; H1hesc; Ag04450; Sknshra; Mcf7
Method for Estimation RNA-Seq with Rnase R resistance
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases HSA_CIRCpedia_909 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr10:128768965-128926028
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type Liver_T6;NHEK;Liver_N11;HUVEC;Liver_T12;Temporal;H1;Liver_N14;Liver_T14;Liver_N6;Lung;Diencephalon;Thyroid;Stomach;AG04450;Heart;Liver_T11;Liver_T17;Liver_N22;Liver_T19;Liver_T22
Method for Estimation Ribo-;poly(A)-
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases hsa_circRNA_100722 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr10:128768965-128926028:+
CircRNA type exonic Gene ID ENSG00000150760.8;ENSG00000232935.2;ENSG00000223528.3
Gene Name DOCK1;RP11-223P11.2;RP11-223P11.3 Detection pipeline n/a
Sample Type Esophageal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases hsa_circ_0020397 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr10:128768965-128926028:+
CircRNA type N/A Gene ID ENSG00000150760.8;ENSG00000232935.2;ENSG00000223528.3
Gene Name DOCK1;RP11-223P11.2;RP11-223P11.3 Detection pipeline N/A
Sample Type Colorectal cancer
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer GACCGTGAACCGAACCGTCATTTC
Reverse Primer TCATCCGCTCCTC TGGCATCATAG
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size