| Aliases | hsa_circ_0000378 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr12:12397195-12397589:- | ||||
| CircRNA type | . | Gene ID | ENSG00000070018.4 | ||||
| Gene Name | LRP6 | Detection pipeline | . | ||||
| Sample Type | HEK293; cd_19; Hs68_RNase; Hs68_control; Nhek; K562; Huvec; Bj; Ag04450 | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_7480 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr12:12397195-12397589 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | H9;Liver_N13;SH-SY5Y_D4_exp1;Occipital;Heart;GM12878;Liver_T11;PA1;Diencephalon;BJ;NHEK;Liver_T15;HUVEC;Liver_N11;Liver;SH-SY5Y_D0_exp2;Thyroid;Liver_T14;Liver_T6;Lung;SH-SY5Y_D8_exp2;SH-SY5Y_D2_exp1;SH-SY5Y_D4_exp2;H1;Liver_N14;Liver_N12;Liver_N3;Forebrain;Cortex;Liver_N15;Liver_T12;AG04450;Liver_T7;Liver_T10;Cerebellum;Liver_T8;HepG2;Liver_T13;Stomach;Liver_T3;Temporal;Liver_N6;Liver_N10;Liver_N8;HeLa_S3;Liver_N7;A549;Parietal;K562;Hs68;Liver_N20;Liver_T21;Liver_N22;Liver_T22;Liver_N18;Liver_T18;Liver_T19;Liver_N17;Liver_T20;Liver_N21;Liver_T17;Liver_N19 | ||||||||
| Method for Estimation | poly(A)-;Ribo-;RNaseR | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | chr12:12397195-12397589 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr12:12397195-12397589:n/a | ||||
| CircRNA type | n/a | Gene ID | ENSG00000070018.4 | ||||
| Gene Name | LRP6 | Detection pipeline | UROBORUS | ||||
| Sample Type | gliomas | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circRNA_101015 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr12:12397195-12397589:- | ||||
| CircRNA type | exonic | Gene ID | ENSG00000070018.4 | ||||
| Gene Name | LRP6 | Detection pipeline | n/a | ||||
| Sample Type | Esophageal cancer | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circ_0000378 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr12:12397195-12397589:- | ||||
| CircRNA type | N/A | Gene ID | ENSG00000070018.4 | ||||
| Gene Name | LRP6 | Detection pipeline | N/A | ||||
| Sample Type | Primary Great Saphenous Vein Varicosities | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | TACCCACTGTGAATGTTAGGCT | ||||||||
| Reverse Primer | GAACTTCTGGCAAGGTGGC | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |