| Aliases | hsa_circ_0000181 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr1:212977661-212981190:+ | ||||
| CircRNA type | . | Gene ID | ENSG00000143494.15 | ||||
| Gene Name | VASH2 | Detection pipeline | . | ||||
| Sample Type | cd_34; K562 | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_29902 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr1:212977661-212981190 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | Cortex;Diencephalon;K562;Temporal;Hs68;Liver_N21;Liver_N19;Liver_N17 | ||||||||
| Method for Estimation | Ribo-;poly(A)-;RNaseR | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circ_0000181 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr1:212977661-212981190:+ | ||||
| CircRNA type | N/A | Gene ID | ENSG00000143494.15 | ||||
| Gene Name | VASH2 | Detection pipeline | N/A | ||||
| Sample Type | Gastric cancer | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | GAACTGAATGGGCTTGCTATGAAA | ||||||||
| Reverse Primer | CAGCTGCACTGAGAACATCTCTGA | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |