Aliases hsa_circ_0000026 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr1:21377358-21437876:-
CircRNA type . Gene ID ENSG00000236216.5
Gene Name PPP1R11P1 Detection pipeline .
Sample Type HEK293; Hs68_RNase; Hs68_control; Nhek; K562; Hepg2; Helas3; H1hesc; Gm12878; Bj; Ag04450; A549; Sknshra; Mcf7
Method for Estimation RNA-Seq with Rnase R resistance
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25234927
Aliases HSA_CIRCpedia_29966 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr1:21377358-21437876
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type Cerebellum;HeLa_S3;Stomach;Liver_T14;H1;Liver_T11;PA1;H9;Liver_N6;NHEK;Liver_T12;Liver_N14;Liver_N13;Kidney;A549;Liver_N3;Diencephalon;Liver_T13;Cortex;Liver_N12;Lung;HepG2;Liver_T15;Liver_T6;GM12878;Liver_T3;Liver_N8;Liver_T10;HUVEC;SH-SY5Y_D2_exp1;Heart;Forebrain;Liver;BJ;Liver_N11;K562;Temporal;Occipital;Liver_T8;Liver_N15;Parietal;SH-SY5Y_D0_exp1;AG04450;Liver_T7;Hs68;Liver_N17;Liver_N22;Liver_N19;Liver_T22;Liver_T17;Liver_T18;Liver_N20;Liver_T21;Liver_T19
Method for Estimation Ribo-;poly(A)-;RNaseR
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 30172046
Aliases circ_006810 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr1:21377358-21437876:-
CircRNA type n/a Gene ID ENSG00000236216.5
Gene Name PPP1R11P1 Detection pipeline Find_circ
Sample Type colorectal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25624062
Aliases hsa_circRNA_100086 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr1:21377358-21437876:-
CircRNA type exonic Gene ID ENSG00000236216.5
Gene Name PPP1R11P1 Detection pipeline n/a
Sample Type Esophageal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 27465405
Aliases hsa_circ_0000026 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr1:21377358-21437876:-
CircRNA type N/A Gene ID ENSG00000236216.5
Gene Name PPP1R11P1 Detection pipeline N/A
Sample Type Gastric cancer
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer CCATCCCCTTATTCAGCACAT
Reverse Primer TCCAAACTTCAGTTTCCTCATCA
Pubmed 28737829
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size