| Aliases | hsa_circ_0000190 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr1:224553580-224559125:+ | ||||
| CircRNA type | . | Gene ID | ENSG00000143771.7 | ||||
| Gene Name | CNIH4 | Detection pipeline | . | ||||
| Sample Type | cd_34 | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_30227 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr1:224553580-224559125 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | SH-SY5Y_D2_exp1;PA1;Forebrain;H1;Liver_T3;Temporal;Parietal;Liver_T13;Cortex;Liver_N14;AG04450;Liver_N3;Liver_N13;Occipital;Lung;Liver_N6;GM12878;H9;K562;Liver_N7;NHEK;HeLa_S3;Thyroid;Liver_T14;Liver_N15;Liver_T8;Diencephalon;Cerebellum;Liver_N12;Liver_N11;Liver_T15;A549;SH-SY5Y_D0_exp1;Liver_T7;HUVEC;Stomach;Liver_T12;Liver_N10;Heart;Hs68;Liver_N22;Liver_T18;Liver_T17;Liver_T20;Liver_T22;Liver_N21;Liver_N17;Liver_T19;Liver_N19;Liver_N20;Liver_T21 | ||||||||
| Method for Estimation | Ribo-;RNaseR;poly(A)- | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circ_0000190 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr1:224553580-224559125:+ | ||||
| CircRNA type | N/A | Gene ID | ENSG00000143771.7 | ||||
| Gene Name | CNIH4 | Detection pipeline | N/A | ||||
| Sample Type | Gastric cancer | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | TTGCTCCTTGGGCGCTATAC | ||||||||
| Reverse Primer | AGAGTCCAG CGGCAAAACTA- | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |