| Aliases | hsa_circ_0016760 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr1:227935392-227947186:+ | ||||
| CircRNA type | . | Gene ID | ENSG00000143816.7 | ||||
| Gene Name | WNT9A | Detection pipeline | . | ||||
| Sample Type | K562; H1hesc; Sknshra | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_30382 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr1:227935392-227947186 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | Liver_N11;Stomach;Liver_N3;Cortex;H1;Liver_N13;PA1;Liver_T3;Liver_T10;Liver;Temporal;SH-SY5Y_D2_exp1;Liver_T8;Liver_T15;BJ;Liver_N8;HeLa_S3;Liver_N15;K562;Diencephalon;Liver_N14;Occipital;A549;Hs68;Liver_N17;Liver_N21;Liver_T22;Liver_T19;Liver_N22;Liver_N18 | ||||||||
| Method for Estimation | Ribo-;poly(A)-;RNaseR | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circ_0016760 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr1:227935392-227947186:+ | ||||
| CircRNA type | N/A | Gene ID | ENSG00000143816.7 | ||||
| Gene Name | WNT9A | Detection pipeline | N/A | ||||
| Sample Type | Non small cell Lung Cancer | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | TGCATTGGTGCTCAGAAGCG | ||||||||
| Reverse Primer | TCTGTTCCTGGGTCTGTGTGC | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |