| Aliases | hsa_circ_0008717 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr1:229665945-229678118:- | ||||
| CircRNA type | . | Gene ID | ENSG00000135776.4;ENSG00000199672.1 | ||||
| Gene Name | ABCB10;RNU4-21P | Detection pipeline | . | ||||
| Sample Type | Hs68_RNase; Hs68_control | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_30446 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr1:229665945-229678118 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | A549;Liver_T11;Temporal;Liver_N8;BJ;Diencephalon;Occipital;Cortex;Cerebellum;PA1;Hs68;Liver_T18;Liver_T20 | ||||||||
| Method for Estimation | poly(A)-;Ribo-;RNaseR | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circABCB10/hsa_circ_0008717 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr1:229665945-229678118:- | ||||
| CircRNA type | N/A | Gene ID | ENSG00000135776.4;ENSG00000199672.1 | ||||
| Gene Name | ABCB10;RNU4-21P | Detection pipeline | N/A | ||||
| Sample Type | breast cancer | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | CTAAGGAGTCACAGGAAGACATC | ||||||||
| Reverse Primer | GTAGAATCTCTCAGACTCAAGGTTG | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |