Aliases hsa_circ_0002343 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr1:235643369-235658138:-
CircRNA type . Gene ID ENSG00000168243.10
Gene Name GNG4 Detection pipeline .
Sample Type Hs68_RNase; Hs68_control; Nhek; K562; Hepg2; Helas3; H1hesc; Gm12878; Bj; Ag04450; A549; Sknshra
Method for Estimation RNA-Seq with Rnase R resistance
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25234927
Aliases HSA_CIRCpedia_30727 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr1:235643369-235658138
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type Cortex;H1;H9;Liver_N6;Liver_T11;GM12878;SH-SY5Y_D2_exp1;Liver_T15;HeLa_S3;HepG2;BJ;AG04450;SH-SY5Y_D0_exp1;Liver_T3;Liver_T12;Liver_N15;Liver_T6;Liver_T7;PA1;Forebrain;Temporal;Occipital;Liver_T13;Parietal;Liver_T14;Liver;NHEK;A549;Liver_N11;Liver_N12;K562;Hs68;Liver_T22;Liver_N20;Liver_N21;Liver_T19
Method for Estimation Ribo-;poly(A)-;RNaseR
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 30172046
Aliases hsa_circRNA_100494 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr1:235643369-235658138:-
CircRNA type exonic Gene ID ENSG00000168243.10
Gene Name GNG4 Detection pipeline n/a
Sample Type Esophageal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 27465405
Aliases hsa_circ_0002343 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr1:235643369-235658138:n/a
CircRNA type n/a Gene ID NA
Gene Name NA Detection pipeline n/a
Sample Type cervical carcinoma
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 28080204
Aliases hsa_circ_0002343 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr1:235643369-235658138:-
CircRNA type N/A Gene ID ENSG00000168243.10
Gene Name GNG4 Detection pipeline N/A
Sample Type Cervical carcinoma
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer GTGGTGTGCAGGTGAACAAG
Reverse Primer ACAACACGCCAACTACCACA
Pubmed 28080204
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size