Aliases hsa_circ_0000199 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr1:243708811-243736350:-
CircRNA type . Gene ID ENSG00000232184.1
Gene Name AL662889.1 Detection pipeline .
Sample Type HEK293; cd_19; Hs68_RNase; Hs68_control; Huvec; H1hesc; Bj; Ag04450; A549; Sknshra
Method for Estimation RNA-Seq with Rnase R resistance
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases HSA_CIRCpedia_30935 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr1:243708811-243736350
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type PA1;Heart;Diencephalon;Stomach;H9;Kidney;A549;Liver_N13;Occipital;Cortex;Liver_T12;Liver_T15;Liver_N15;NHEK;Liver_T8;Liver_N6;Liver_T10;Liver_N14;SH-SY5Y_D2_exp1;Parietal;Liver_T11;AG04450;Thyroid;HUVEC;SK_N_SH;Cerebellum;Liver_N11;Liver_N10;SH-SY5Y_D8_exp2;Lung;SH-SY5Y_D0_exp2;Liver;BJ;Liver_N3;Liver_T3;Liver_N12;Temporal;H1;SH-SY5Y_D4_exp1;Forebrain;Liver_T14;Hs68;Liver_N19;Liver_N17;Liver_N21;Liver_T21;Liver_T22;Liver_N22;Liver_T18;Liver_T17;Liver_T19;Liver_N20
Method for Estimation Ribo-;poly(A)-;RNaseR
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases chr1:243708811-243736350 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr1:243708811-243736350:n/a
CircRNA type n/a Gene ID ENSG00000117020.12;ENSG00000236031.1
Gene Name AKT3;RP11-269F20.1 Detection pipeline UROBORUS
Sample Type gliomas
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases hsa_circRNA_100503 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr1:243708811-243736350:-
CircRNA type exonic Gene ID ENSG00000232184.1
Gene Name AL662889.1 Detection pipeline n/a
Sample Type Esophageal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases chr4:103501692-103504114 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr1:243708811-243736350:-
CircRNA type N/A Gene ID ENSG00000232184.1
Gene Name AL662889.1 Detection pipeline N/A
Sample Type Gliomas
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer TGGAGTCTGGGAAGGATTTG
Reverse Primer ATTTCCTCCCCTCCAGTCAC
Aliases hsa_circ_0000199 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr1:243708811-243736350:-
CircRNA type N/A Gene ID ENSG00000232184.1
Gene Name AL662889.1 Detection pipeline N/A
Sample Type Gliomas
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer TCATTGCTTTCAGGGCTCTT
Reverse Primer ATAGAAACGTGTGCGGTCCT
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size