| Aliases | hsa_circ_0026143 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr12:49722709-49723237:+ | ||||
| CircRNA type | . | Gene ID | ENSG00000135451.8 | ||||
| Gene Name | TROAP | Detection pipeline | . | ||||
| Sample Type | Hepg2; Helas3; Gm12878; Bj; A549 | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_8605 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr12:49722709-49723237 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | HepG2;Liver_T6;HeLa_S3;BJ;A549;GM12878;H1;Hs68 | ||||||||
| Method for Estimation | poly(A)-;Ribo-;RNaseR | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circRNA_101051 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr12:49722709-49723237:+ | ||||
| CircRNA type | exonic | Gene ID | ENSG00000135451.8 | ||||
| Gene Name | TROAP | Detection pipeline | n/a | ||||
| Sample Type | Esophageal cancer | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circ_0026143 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr12:49722709-49723237:n/a | ||||
| CircRNA type | n/a | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | n/a | ||||
| Sample Type | cervical carcinoma | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circ_0026143 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr12:49722709-49723237:+ | ||||
| CircRNA type | N/A | Gene ID | ENSG00000135451.8 | ||||
| Gene Name | TROAP | Detection pipeline | N/A | ||||
| Sample Type | Ovarian endometriosis | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | GCGTCTCACCGTTCAACCTAA | ||||||||
| Reverse Primer | CATCAGGTGGGAGTCATGGCT | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |