| Aliases | hsa_circ_0000414 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr12:66597490-66605377:+ | ||||
| CircRNA type | . | Gene ID | ENSG00000090376.4 | ||||
| Gene Name | IRAK3 | Detection pipeline | . | ||||
| Sample Type | cd_34; Hs68_RNase; Hs68_control | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_66605 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr12:66597490-66605377 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | Cerebellum;Lung;Liver_T8;Temporal;Parietal;Cortex;Occipital;Liver_N3;Hs68;Liver_N19;Liver_N20;Liver_T17 | ||||||||
| Method for Estimation | Ribo-;RNaseR | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circ_0000414 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr12:66597490-66605377:+ | ||||
| CircRNA type | N/A | Gene ID | ENSG00000090376.4 | ||||
| Gene Name | IRAK3 | Detection pipeline | N/A | ||||
| Sample Type | Pulmonary tuberculosis | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | GGAGAAGGAGAGATTTTTGAGG | ||||||||
| Reverse Primer | GTGCCCAGGACCAAAGTAAT | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |