| Aliases | hsa_circ_0006913 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr1:27087346-27089776:+ | ||||
| CircRNA type | . | Gene ID | ENSG00000117713.13 | ||||
| Gene Name | ARID1A | Detection pipeline | . | ||||
| Sample Type | Hs68_RNase; Hs68_control; Hsmm; Hepg2; Helas3; H1hesc | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_31139 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr1:27087346-27089776 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | HeLa_S3;Thyroid;H9;Parietal;Occipital;Liver_T12;AG04450;PA1;SH-SY5Y_D2_exp1;H1;HepG2;Liver_N13;GM12878;Cortex;Diencephalon;Hs68;Liver_N19;Liver_N20;Liver_N17 | ||||||||
| Method for Estimation | poly(A)-;Ribo-;RNaseR | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circRNA_100110 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr1:27087346-27089776:+ | ||||
| CircRNA type | exonic | Gene ID | ENSG00000117713.13 | ||||
| Gene Name | ARID1A | Detection pipeline | n/a | ||||
| Sample Type | Esophageal cancer | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circ_0006913 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr1:27087346-27089776:+ | ||||
| CircRNA type | N/A | Gene ID | ENSG00000117713.13 | ||||
| Gene Name | ARID1A | Detection pipeline | N/A | ||||
| Sample Type | Pancreatic Ductal Adenocarcinoma | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | AAACCCAAGAAACTGCTGCTGTCG | ||||||||
| Reverse Primer | CTGGAAATCCCTGATGTGCTC | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |