| Aliases | hsa_circ_0008509 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr12:78334098-78415642:+ | ||||
| CircRNA type | . | Gene ID | ENSG00000067798.9 | ||||
| Gene Name | NAV3 | Detection pipeline | . | ||||
| Sample Type | Hs68_RNase; Hs68_control; Nhek; Huvec; Hsmm; Bj; Ag04450; Sknshra | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_9629 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr12:78334098-78415642 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | Liver_N12;Cortex;AG04450;Diencephalon;Cerebellum;Liver_T13;Forebrain;NHEK;BJ;HUVEC;Temporal;Parietal;Occipital;Hs68;Liver_N19 | ||||||||
| Method for Estimation | Ribo-;poly(A)-;RNaseR | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circ_0008509 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr12:78334098-78415642:+ | ||||
| CircRNA type | N/A | Gene ID | ENSG00000067798.9 | ||||
| Gene Name | NAV3 | Detection pipeline | N/A | ||||
| Sample Type | Colorectal cancer | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | CACCATTCATTTACAGGGCACA | ||||||||
| Reverse Primer | CGCTTGTGGCCTGATTTTG | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |