Aliases hsa_circ_0003519 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr10:31644075-31676195:+
CircRNA type . Gene ID ENSG00000196960.3;ENSG00000230397.1;ENSG00000148516.17
Gene Name RP11-192P3.5;SPTLC1P1;ZEB1 Detection pipeline .
Sample Type Hs68_RNase; Hs68_control
Method for Estimation RNA-Seq with Rnase R resistance
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25234927
Aliases HSA_CIRCpedia_1446 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr10:31644075-31676195
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type GM12878;AG04450;A549;Liver_T13;Heart;PA1;HepG2;Parietal;Liver_N13;HeLa_S3;Stomach;Liver_N6;Diencephalon;Liver_T15;Liver_T11;Liver_N12;Liver_T12;K562;Liver;Cortex;HUVEC;BJ;Liver_N3;Forebrain;Liver_N7;Hs68;Liver_N17;Liver_N19;Liver_N21;Liver_T22
Method for Estimation poly(A)-;Ribo-;RNaseR
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 30172046
Aliases hsa_circ_0003519 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr10:31644075-31676195:+
CircRNA type N/A Gene ID ENSG00000196960.3;ENSG00000230397.1;ENSG00000148516.17
Gene Name RP11-192P3.5;SPTLC1P1;ZEB1 Detection pipeline N/A
Sample Type Active Pulmonary Tuberculosis
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer CTCCTGCACCAAGAAAGATC
Reverse Primer CCAATGCCTGCTCTGTCTTC
Pubmed 28846924
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size