Aliases hsa_circ_0000504 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr13:113170753-113181798:-
CircRNA type . Gene ID ENSG00000126216.8
Gene Name TUBGCP3 Detection pipeline .
Sample Type HEK293; cd_19; Hs68_RNase; Hs68_control; Nhek; K562; Huvec; Hepg2; Helas3; H1hesc; Gm12878; Bj; Ag04450; A549; Sknshra; Mcf7
Method for Estimation RNA-Seq with Rnase R resistance
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25234927
Aliases HSA_CIRCpedia_10108 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr13:113170753-113181798
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type GM12878;HepG2;HeLa_S3;HUVEC;Thyroid;SH-SY5Y_D2_exp1;SH-SY5Y_D0_exp1;Liver;Occipital;Diencephalon;Liver_N12;Liver_N8;Liver_N3;Forebrain;PA1;A549;K562;Liver_T12;NHEK;SH-SY5Y_D0_exp2;Parietal;Liver_T11;Temporal;Liver_N15;Stomach;SH-SY5Y_D4_exp2;H9;Liver_T8;Liver_T6;Liver_N10;Liver_N6;Liver_N7;Heart;Liver_T3;Liver_T13;Liver_T7;Cerebellum;SH-SY5Y_D4_exp1;Liver_T10;Lung;BJ;Liver_T14;Liver_T15;Cortex;Liver_N13;Kidney;AG04450;Liver_N11;SH-SY5Y_D8_exp2;Liver_N14;H1;Hs68;Liver_T20;Liver_N19;Liver_T18;Liver_N20;Liver_T19;Liver_T22;Liver_T21;Liver_N21;Liver_N17;Liver_T17;Liver_N18;Liver_N22
Method for Estimation poly(A)-;Ribo-;RNaseR
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 30172046
Aliases circ_006907 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr13:113170753-113181798:-
CircRNA type n/a Gene ID ENSG00000126216.8
Gene Name TUBGCP3 Detection pipeline Find_circ
Sample Type colorectal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25624062
Aliases hsa_circRNA_101300 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr13:113170753-113181798:-
CircRNA type exonic Gene ID ENSG00000126216.8
Gene Name TUBGCP3 Detection pipeline n/a
Sample Type Esophageal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 27465405
Aliases hsa_circ_0000504 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr13:113170753-113181798:-
CircRNA type N/A Gene ID ENSG00000126216.8
Gene Name TUBGCP3 Detection pipeline N/A
Sample Type Colorectal cancer
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer GCAAAGCTCCTGAGAAACAT
Reverse Primer AAAAGGACCTTCCTAGACTGAT
Pubmed 28656150
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size