| Aliases | hsa_circ_0018168 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr10:34558584-34573173:- | ||||
| CircRNA type | . | Gene ID | ENSG00000148498.15 | ||||
| Gene Name | PARD3 | Detection pipeline | . | ||||
| Sample Type | Nhek; Huvec; Hepg2; H1hesc; Gm12878; Bj; Ag04450; A549; Sknshra | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_1534 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr10:34558584-34573173 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | Liver_N11;Forebrain;Liver_T10;Parietal;Liver_N10;SH-SY5Y_D4_exp1;A549;Cerebellum;Liver_T12;SK_N_SH;Liver_T6;PA1;SH-SY5Y_D0_exp1;Occipital;Stomach;Liver_N14;Liver_T13;Liver_N15;Liver_T3;H1;HepG2;Liver;Liver_N6;Liver_T7;SH-SY5Y_D2_exp1;K562;AG04450;Thyroid;BJ;Liver_N8;Liver_T11;Liver_T15;Heart;Liver_N12;Liver_N3;Cortex;HUVEC;Liver_T14;Temporal;Liver_T8;Lung;SH-SY5Y_D0_exp2;Diencephalon;Kidney;Liver_N13;H9;GM12878;Liver_N7;Hs68;Liver_T18;Liver_N22;Liver_N21;Liver_T20;Liver_T19;Liver_N19;Liver_N20;Liver_N18;Liver_T22;Liver_T21;Liver_N17;Liver_T17 | ||||||||
| Method for Estimation | Ribo-;poly(A)-;RNaseR | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_009236 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr10:34558584-34573173:- | ||||
| CircRNA type | n/a | Gene ID | ENSG00000148498.15 | ||||
| Gene Name | PARD3 | Detection pipeline | Find_circ | ||||
| Sample Type | colorectal cancer | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circRNA_0018168 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr10:34558584-34573173:- | ||||
| CircRNA type | N/A | Gene ID | ENSG00000148498.15 | ||||
| Gene Name | PARD3 | Detection pipeline | N/A | ||||
| Sample Type | Acne | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | TAGACCTCAGAGCCCACGAG | ||||||||
| Reverse Primer | TGCTTCATTCGTATCCTCTCCTC | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |