| Aliases | chr13:28748408|28752072 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr13:28748408-28752072:n/a | ||||
| CircRNA type | n/a | Gene ID | ENSG00000152520.9 | ||||
| Gene Name | PAN3 | Detection pipeline | n/a | ||||
| Sample Type | Breast cancer | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circ_0004372 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr13:28748408-28752072:+ | ||||
| CircRNA type | . | Gene ID | ENSG00000152520.9 | ||||
| Gene Name | PAN3 | Detection pipeline | . | ||||
| Sample Type | Hs68_RNase; Hs68_control; Nhek; K562; Hepg2; Helas3; H1hesc; Gm12878; Bj; Ag04450; A549; Sknshra | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_10462 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr13:28748408-28752072 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | H9;Lung;HeLa_S3;Liver_T13;Liver_T8;Liver_T10;SH-SY5Y_D0_exp1;SH-SY5Y_D4_exp2;BJ;Occipital;Liver_T6;A549;Liver_N8;GM12878;Liver_T15;Forebrain;Heart;PA1;Cortex;Liver_N10;Liver_T7;Liver_N15;SH-SY5Y_D8_exp2;Liver;Cerebellum;Liver_N12;Liver_N6;Liver_T3;Diencephalon;NHEK;H1;Thyroid;Kidney;Parietal;K562;Liver_T12;HepG2;Liver_N3;SH-SY5Y_D4_exp1;Liver_N14;Liver_T14;Liver_T11;Temporal;Liver_N13;Liver_N7;AG04450;Liver_N11;SH-SY5Y_D0_exp2;Stomach;Hs68;Liver_T18;Liver_N22;Liver_N20;Liver_N18;Liver_T22;Liver_T19;Liver_T21;Liver_N17;Liver_N19;Liver_N21;Liver_T17 | ||||||||
| Method for Estimation | Ribo-;poly(A)-;RNaseR | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circ_007770 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr13:28748408-28752072:+ | ||||
| CircRNA type | n/a | Gene ID | ENSG00000152520.9 | ||||
| Gene Name | PAN3 | Detection pipeline | Find_circ | ||||
| Sample Type | colorectal cancer | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | chr13:28748408-28752072 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr13:28748408-28752072:n/a | ||||
| CircRNA type | n/a | Gene ID | ENSG00000152520.9 | ||||
| Gene Name | PAN3 | Detection pipeline | UROBORUS | ||||
| Sample Type | gliomas | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circRNA_101238 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr13:28748408-28752072:+ | ||||
| CircRNA type | exonic | Gene ID | ENSG00000152520.9 | ||||
| Gene Name | PAN3 | Detection pipeline | n/a | ||||
| Sample Type | Esophageal cancer | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circRNA_101238/hsa_circ_0004372 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr13:28748408-28752072:+ | ||||
| CircRNA type | N/A | Gene ID | ENSG00000152520.9 | ||||
| Gene Name | PAN3 | Detection pipeline | N/A | ||||
| Sample Type | Thoracic Aortic Dissection | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | CCAATAAAGCTGGTGCTAAAATAGGA | ||||||||
| Reverse Primer | CTTGTTTAATGACTTTGGTGCCCT | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |