| Aliases | HSA_CIRCpedia_11424 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr14:102466325-102500789 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | NHEK | ||||||||
| Method for Estimation | poly(A)- | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | MCF7_circ_000595 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr14:102466325-102500789:+ | ||||
| CircRNA type | N/A | Gene ID | ENSG00000196663.15 | ||||
| Gene Name | TECPR2 | Detection pipeline | N/A | ||||
| Sample Type | breast cancer | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | GTACAGATATTGCCAGGACGG | ||||||||
| Reverse Primer | TCCTTCAGCCTACCAAACTTC | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |