| Aliases | hsa_circ_0011946 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr1:41578954-41618413:- | ||||
| CircRNA type | . | Gene ID | ENSG00000010803.12 | ||||
| Gene Name | SCMH1 | Detection pipeline | . | ||||
| Sample Type | A549; Sknshra; Mcf7 | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_31884 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr1:41578954-41618413 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | Parietal;Liver_T11;A549;Liver;Temporal;Occipital;Liver_N7;Heart;Hs68;Liver_T20;Liver_N22;Liver_N17;Liver_T18;Liver_N18 | ||||||||
| Method for Estimation | Ribo-;poly(A)-;RNaseR | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circ_0011946 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr1:41578954-41618413:- | ||||
| CircRNA type | N/A | Gene ID | ENSG00000010803.12 | ||||
| Gene Name | SCMH1 | Detection pipeline | N/A | ||||
| Sample Type | breast cancer | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | GCTGGTGTTCCTTGACTGGA | ||||||||
| Reverse Primer | CACTGTAGCAAACCAGCATTTCT | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |