Aliases hsa_circ_0002968 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr10:49609654-49618211:+
CircRNA type . Gene ID ENSG00000187714.6
Gene Name SLC18A3 Detection pipeline .
Sample Type Hs68_RNase; Hs68_control; Nhek; K562; Huvec; Hepg2; Helas3; H1hesc; Gm12878; Bj; Ag04450; Sknshra
Method for Estimation RNA-Seq with Rnase R resistance
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25234927
Aliases HSA_CIRCpedia_1733 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr10:49609654-49618211
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type Liver_N14;Stomach;Liver_N3;Cerebellum;Temporal;Liver_T3;SH-SY5Y_D4_exp1;Liver_T14;SH-SY5Y_D2_exp1;NHEK;Liver_N6;Diencephalon;SH-SY5Y_D0_exp1;PA1;GM12878;Liver_N8;Thyroid;Lung;Liver_N15;SH-SY5Y_D8_exp2;Parietal;Liver_T6;Occipital;Liver_N7;SH-SY5Y_D0_exp2;Liver_T7;SH-SY5Y_D4_exp2;K562;HUVEC;Forebrain;Kidney;Cortex;Liver_T10;Liver_N10;Liver_N12;Liver_N13;BJ;Heart;HeLa_S3;H9;Liver_T13;Liver_T12;AG04450;Liver_N11;Liver;Liver_T8;H1;A549;Liver_T11;Hs68;Liver_N17;Liver_T20;Liver_N22;Liver_T22;Liver_N20;Liver_T18;Liver_T21;Liver_N19;Liver_T19;Liver_N18;Liver_T17
Method for Estimation Ribo-;poly(A)-;RNaseR
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 30172046
Aliases circ_008777 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr10:49609654-49618211:+
CircRNA type n/a Gene ID ENSG00000187714.6
Gene Name SLC18A3 Detection pipeline Find_circ
Sample Type colorectal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25624062
Aliases hsa_circRNA_100589 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr10:49609654-49618211:+
CircRNA type exonic Gene ID ENSG00000187714.6
Gene Name SLC18A3 Detection pipeline n/a
Sample Type Esophageal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 27465405
Aliases hsa_circ_0002968 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr10:49609654-49618211:+
CircRNA type N/A Gene ID ENSG00000187714.6
Gene Name SLC18A3 Detection pipeline N/A
Sample Type Gliomas
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer GGAGCTCATGGATGCAAATC
Reverse Primer TTGTTGTCACGCTTGCTTCT
Pubmed 28236760
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size