Aliases hsa_circ_0000523 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr14:21971315-21972024:-
CircRNA type . Gene ID ENSG00000165819.7
Gene Name METTL3 Detection pipeline .
Sample Type cd_19; cd_34; Hs68_RNase; Hs68_control; Nhek; K562; Huvec; Hsmm; Hepg2; Helas3; H1hesc; Gm12878; Bj; Ag04450; A549; Sknshra; Mcf7
Method for Estimation RNA-Seq with Rnase R resistance
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25234927
Aliases HSA_CIRCpedia_11697 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr14:21971315-21972024
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type Liver_N3;Parietal;Liver_T7;Liver_T8;SH-SY5Y_D0_exp1;SH-SY5Y_D8_exp2;Liver_N12;Cerebellum;GM12878;Kidney;K562;H9;SH-SY5Y_D4_exp1;Liver_T11;HUVEC;Liver_T12;Lung;Liver_T15;PA1;H1;Liver_N14;AG04450;A549;Liver_N11;Liver_N8;Temporal;Stomach;Liver_N7;Heart;HepG2;BJ;Diencephalon;Liver_N6;SH-SY5Y_D2_exp1;Liver_N13;Liver_N15;HeLa_S3;NHEK;Cortex;Forebrain;Thyroid;Liver_T13;Occipital;Liver;SH-SY5Y_D0_exp2;Liver_N10;SH-SY5Y_D4_exp2;Liver_T3;Liver_T14;Liver_T10;Hs68;Liver_T20;Liver_T22;Liver_T18;Liver_N17;Liver_N19;Liver_N21;Liver_N18;Liver_N20;Liver_T21;Liver_T17;Liver_T19;Liver_N22
Method for Estimation Ribo-;poly(A)-;RNaseR
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 30172046
Aliases circ_006229 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr14:21971315-21972024:-
CircRNA type n/a Gene ID ENSG00000165819.7
Gene Name METTL3 Detection pipeline Find_circ
Sample Type colorectal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25624062
Aliases chr14:21971315-21972024 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr14:21971315-21972024:n/a
CircRNA type n/a Gene ID ENSG00000165819.7
Gene Name METTL3 Detection pipeline UROBORUS
Sample Type gliomas
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 26873924
Aliases hsa_circRNA_101316 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr14:21971315-21972024:-
CircRNA type exonic Gene ID ENSG00000165819.7
Gene Name METTL3 Detection pipeline n/a
Sample Type Esophageal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 27465405
Aliases circ6229/hsa_circ_0000523 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr14:21971315-21972024:-
CircRNA type N/A Gene ID ENSG00000165819.7
Gene Name METTL3 Detection pipeline N/A
Sample Type Colorectal cancer
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer CGGAAGGTTGGAGACAATGC
Reverse Primer GTCCACTAAGGAACAACAGAGCAA
Pubmed 25624062
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size