Aliases hsa_circ_0031288 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr14:23793346-23793498:+
CircRNA type . Gene ID ENSG00000258643.1;ENSG00000100836.6
Gene Name BCL2L2-PABPN1;PABPN1 Detection pipeline .
Sample Type Nhek; K562; Hepg2; Helas3; H1hesc; Gm12878; Bj; Sknshra
Method for Estimation RNA-Seq with Rnase R resistance
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25234927
Aliases HSA_CIRCpedia_11760 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr14:23793346-23793498
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type PA1;Diencephalon;Liver_N11;NHEK;GM12878;Liver_N14;SH-SY5Y_D4_exp1;BJ;H1;HepG2;HeLa_S3;Parietal;Heart;Hs68;Liver_N22
Method for Estimation RNaseR;Ribo-;poly(A)-
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 30172046
Aliases hsa_circRNA_101325 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr14:23793346-23793498:+
CircRNA type exonic Gene ID ENSG00000258643.1;ENSG00000100836.6
Gene Name BCL2L2-PABPN1;PABPN1 Detection pipeline n/a
Sample Type Esophageal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 27465405
Aliases hsa_circ_0031288 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr14:23793346-23793498:n/a
CircRNA type n/a Gene ID NA
Gene Name NA Detection pipeline n/a
Sample Type cervical carcinoma
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 28080204
Aliases hsa circ 0031288/circPABPN1 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr14:23793346-23793498:+
CircRNA type N/A Gene ID ENSG00000258643.1;ENSG00000100836.6
Gene Name BCL2L2-PABPN1;PABPN1 Detection pipeline N/A
Sample Type Cervical carcinoma
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer GGACCACCAACTACAACAGC
Reverse Primer TTGGGATCACCTGTAGACGC
Pubmed 28080204
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size