Aliases hsa_circ_0005836 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr14:39623414-39627606:-
CircRNA type . Gene ID ENSG00000241984.2;ENSG00000182400.10
Gene Name RPL7AP2;TRAPPC6B Detection pipeline .
Sample Type Hs68_RNase; Hs68_control; K562; Helas3; Gm12878; Bj; Ag04450
Method for Estimation RNA-Seq with Rnase R resistance
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25234927
Aliases HSA_CIRCpedia_12127 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr14:39623414-39627606
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type Liver_N7;Liver_N15;PA1;Liver;Liver_N13;Liver_T14;H1;Occipital;Liver_N11;Liver_N8;Temporal;H9;Cortex;Forebrain;Liver_N12;Lung;K562;Liver_T7;Cerebellum;Diencephalon;Stomach;BJ;SH-SY5Y_D4_exp1;Liver_T13;HUVEC;Parietal;Hs68;Liver_T22;Liver_T17;Liver_N22;Liver_T21;Liver_T18;Liver_N20;Liver_N18;Liver_N19;Liver_T19;Liver_T20
Method for Estimation Ribo-;poly(A)-;RNaseR
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 30172046
Aliases hsa_circ_0005836 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr14:39623414-39627606:-
CircRNA type N/A Gene ID ENSG00000241984.2;ENSG00000182400.10
Gene Name RPL7AP2;TRAPPC6B Detection pipeline N/A
Sample Type Active Pulmonary Tuberculosis
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer ACTCATCCTTGAACCTTGC
Reverse Primer GGCATCTATGTACTTCAGGAC
Pubmed 28846924
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size