Aliases hsa_circ_0000069 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr1:47745912-47748131:-
CircRNA type . Gene ID ENSG00000123473.11
Gene Name STIL Detection pipeline .
Sample Type HEK293; Hs68_RNase; Hs68_control; Nhek; K562; Huvec; Hmec; Hepg2; Helas3; H1hesc; Gm12878; Bj; Ag04450; A549; Sknshra; Mcf7
Method for Estimation RNA-Seq with Rnase R resistance
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25234927
Aliases HSA_CIRCpedia_32180 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr1:47745912-47748131
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type Liver_N12;K562;HeLa_S3;Liver_T3;Occipital;Liver_T12;Temporal;PA1;NHEK;SK_N_SH;SH-SY5Y_D4_exp1;Liver_T7;GM12878;Liver_T13;Cortex;H9;Diencephalon;Cerebellum;Liver_T8;SH-SY5Y_D2_exp1;H1;Liver_T6;BJ;HUVEC;SH-SY5Y_D8_exp2;A549;Parietal;Liver_T15;Liver;Liver_N10;Liver_N8;AG04450;Forebrain;HepG2;Liver_T14;Heart;Hs68;Liver_N22;Liver_T17;Liver_T19;Liver_N17;Liver_T22;Liver_T18;Liver_T21
Method for Estimation Ribo-;poly(A)-;RNaseR
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 30172046
Aliases hsa_circRNA_100213 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr1:47745912-47748131:-
CircRNA type exonic Gene ID ENSG00000123473.11
Gene Name STIL Detection pipeline n/a
Sample Type Esophageal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 27465405
Aliases hsa_circ_0000069 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr1:47745912-47748131:-
CircRNA type N/A Gene ID ENSG00000123473.11
Gene Name STIL Detection pipeline N/A
Sample Type Colorectal cancer
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer CTACTTCAGGCACAGGTCTTC
Reverse Primer CTGACTCACTGGATGAGGACT
Pubmed 28003761
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size