| Aliases | hsa_circ_0032821 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr14:81209418-81227957:- | ||||
| CircRNA type | . | Gene ID | ENSG00000165417.11 | ||||
| Gene Name | GTF2A1 | Detection pipeline | . | ||||
| Sample Type | K562; Ag04450; A549; Sknshra | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_13232 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr14:81209418-81227957 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | Forebrain;Diencephalon;Parietal;H9;Kidney;Liver_T13;Occipital;Liver;A549;Stomach;Liver_T12;Temporal;Cortex;AG04450;Liver_N14;Liver_N3;PA1;Cerebellum;SH-SY5Y_D0_exp1;Liver_N13;Thyroid;Liver_T3;Liver_T14;Liver_T11;Hs68;Liver_T17;Liver_N17;Liver_T22 | ||||||||
| Method for Estimation | Ribo-;RNaseR;poly(A)- | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circRNA_101416 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr14:81209418-81227957:- | ||||
| CircRNA type | exonic | Gene ID | ENSG00000165417.11 | ||||
| Gene Name | GTF2A1 | Detection pipeline | n/a | ||||
| Sample Type | Esophageal cancer | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circ_0032821 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr14:81209418-81227957:- | ||||
| CircRNA type | N/A | Gene ID | ENSG00000165417.11 | ||||
| Gene Name | GTF2A1 | Detection pipeline | N/A | ||||
| Sample Type | Gastric cancer | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | AGATAGAAAGGCAGGAGCAG | ||||||||
| Reverse Primer | TGTTCAGTCTCCAAGCAAAG | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |