| Aliases | hsa_circ_0032891 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr14:90397884-90398971:n/a | ||||
| CircRNA type | n/a | Gene ID | ENSG00000140025.11;ENSG00000259053.1 | ||||
| Gene Name | EFCAB11;RP11-33N16.3 | Detection pipeline | n/a | ||||
| Sample Type | multiple system atrophy | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circ_0032891 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr14:90397884-90398971:- | ||||
| CircRNA type | . | Gene ID | ENSG00000140025.11;ENSG00000259053.1 | ||||
| Gene Name | EFCAB11;RP11-33N16.3 | Detection pipeline | . | ||||
| Sample Type | Ag04450; A549 | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_13338 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr14:90397884-90398971 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | SH-SY5Y_D2_exp1;PA1;Forebrain;Heart;Cortex;Liver_N7;Liver_T12;Occipital;H9;BJ;Lung;Liver_T14;SH-SY5Y_D0_exp1;Liver_N6;SH-SY5Y_D4_exp2;Temporal;Cerebellum;Parietal;Diencephalon;Hs68;Liver_T22;Liver_T21;Liver_T19;Liver_N17 | ||||||||
| Method for Estimation | Ribo-;RNaseR;poly(A)- | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | EFCAB11/hsa_circ_0032891 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr14:90397884-90398971:- | ||||
| CircRNA type | N/A | Gene ID | ENSG00000140025.11;ENSG00000259053.1 | ||||
| Gene Name | EFCAB11;RP11-33N16.3 | Detection pipeline | N/A | ||||
| Sample Type | Multiple system atrophy (MSA) | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | AGCTCAACGATATCGGAACGA | ||||||||
| Reverse Primer | CCTCGAGTAATATACCTGAATACCT | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |