| Aliases | chr14:99723807|99724176 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr14:99723807-99724176:n/a | ||||
| CircRNA type | n/a | Gene ID | ENSG00000127152.13 | ||||
| Gene Name | BCL11B | Detection pipeline | n/a | ||||
| Sample Type | Breast cancer | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circ_0033144 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr14:99723807-99724176:- | ||||
| CircRNA type | . | Gene ID | ENSG00000036530.8 | ||||
| Gene Name | CYP46A1 | Detection pipeline | . | ||||
| Sample Type | Nhek; H1hesc; Gm12878; A549 | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_13563 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr14:99723807-99724176 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | Liver_N10;Parietal;PA1;Liver_N14;Thyroid;Occipital;Liver_N15;Liver_N12;H9;Forebrain;Stomach;Temporal;Diencephalon;H1;Liver_T11;Liver_T8;Liver_T12;Liver_T7;Liver;Liver_N8;Cortex;Liver_N3;Liver_N11;GM12878;Liver_N6;Liver_T3;Liver_N13;Liver_T14;NHEK;Liver_N21;Liver_T17;Liver_T20;Liver_T21;Liver_T18;Liver_T22;Liver_N17;Liver_N20;Liver_N19;Liver_T19;Liver_N22;Liver_N18 | ||||||||
| Method for Estimation | Ribo-;RNaseR;poly(A)- | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circRNA_101435 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr14:99723807-99724176:- | ||||
| CircRNA type | exonic | Gene ID | ENSG00000036530.8 | ||||
| Gene Name | CYP46A1 | Detection pipeline | n/a | ||||
| Sample Type | Esophageal cancer | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | circBCL11B | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr14:99723807-99724176:- | ||||
| CircRNA type | N/A | Gene ID | ENSG00000036530.8 | ||||
| Gene Name | CYP46A1 | Detection pipeline | N/A | ||||
| Sample Type | breast cancer | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | ACGAAAGGCATCTGTCCCAA | ||||||||
| Reverse Primer | TTGTGCTCTATAAAAACCAGGATGT | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |