Aliases hsa_circ_0000567 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr14:99924615-99932150:-
CircRNA type . Gene ID ENSG00000183576.8
Gene Name SETD3 Detection pipeline .
Sample Type HEK293; cd_19; cd_34; Hs68_RNase; Hs68_control; Nhek; K562; Huvec; Hepg2; Helas3; H1hesc; Gm12878; Bj; Ag04450; A549; Sknshra
Method for Estimation RNA-Seq with Rnase R resistance
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25234927
Aliases HSA_CIRCpedia_13569 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr14:99924615-99932150
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type Liver_T15;Liver_T13;Liver_N13;SH-SY5Y_D4_exp2;H9;HepG2;A549;Occipital;HeLa_S3;Liver_T14;SH-SY5Y_D0_exp2;Liver_T8;NHEK;Temporal;Thyroid;Liver_T7;SK_N_SH;Liver_T11;Forebrain;PA1;Liver;Liver_T12;Liver_N6;Liver_N3;Liver_N8;Heart;Liver_N10;Kidney;HUVEC;Cerebellum;SH-SY5Y_D4_exp1;AG04450;Liver_N15;K562;Liver_T3;Cortex;Liver_T10;Liver_N12;GM12878;BJ;Diencephalon;Liver_N11;Stomach;H1;Parietal;Liver_T6;SH-SY5Y_D8_exp2;Lung;SH-SY5Y_D0_exp1;Liver_N7;SH-SY5Y_D2_exp1;Liver_N14;Hs68;Liver_T20;Liver_N18;Liver_T19;Liver_N21;Liver_N22;Liver_N20;Liver_N19;Liver_T22;Liver_N17;Liver_T21;Liver_T17;Liver_T18
Method for Estimation Ribo-;poly(A)-;RNaseR
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 30172046
Aliases circ_009039 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr14:99924615-99932150:-
CircRNA type n/a Gene ID ENSG00000183576.8
Gene Name SETD3 Detection pipeline Find_circ
Sample Type colorectal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25624062
Aliases chr14:99924615-99932150 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr14:99924615-99932150:n/a
CircRNA type n/a Gene ID ENSG00000183576.8
Gene Name SETD3 Detection pipeline UROBORUS
Sample Type gliomas
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 26873924
Aliases hsa_circRNA_101436 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr14:99924615-99932150:-
CircRNA type exonic Gene ID ENSG00000183576.8
Gene Name SETD3 Detection pipeline n/a
Sample Type Esophageal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 27465405
Aliases hsa_circ_0000567 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr14:99924615-99932150:-
CircRNA type N/A Gene ID ENSG00000183576.8
Gene Name SETD3 Detection pipeline N/A
Sample Type Colorectal cancer
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer AGTTCGGTATCTTCAGTCCACAC
Reverse Primer TCTTACCCATTTTTCTGACTGGATG
Pubmed 29333615
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size