Aliases HSA_CIRCpedia_1949 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr10:64966354-64968995
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type Diencephalon;Temporal;Liver_T14;Liver_T7;AG04450;Cortex;Parietal;A549;Liver_N14;Liver_T12;Liver_N11;Lung;Liver_N15;Liver_N6;SH-SY5Y_D0_exp2;Liver_N12;Liver_N7;Cerebellum;Forebrain;PA1;Occipital;Liver_N19;Liver_T21;Liver_N18;Liver_T18;Liver_N17
Method for Estimation Ribo-;poly(A)-
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Aliases hsa_circ_0093859 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr10:64966354-64968995:-
CircRNA type N/A Gene ID NA
Gene Name NA Detection pipeline N/A
Sample Type breast cancer
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer ACCCAATGGAGTTCTCAGCAG
Reverse Primer TGGAAGGTCTGACAGGAATGTG
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size