| Aliases | hsa_circ_0004619 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr1:51121113-51210447:- | ||||
| CircRNA type | . | Gene ID | ENSG00000203356.2 | ||||
| Gene Name | LINC01562 | Detection pipeline | . | ||||
| Sample Type | Hs68_RNase; Hs68_control; K562; Helas3; Gm12878 | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_32234 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr1:51121113-51210447 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | Liver_T15;Cerebellum;Liver_T3;Liver_N14;Occipital;Liver_N15;Liver_N12;Liver_T8;Liver_T6;GM12878;Thyroid;Temporal;SH-SY5Y_D0_exp1;Liver_N11;Liver_T13;Forebrain;HeLa_S3;Cortex;K562;Liver_T12;PA1;Heart;Liver_N8;Liver_N7;Liver_T14;Diencephalon;Liver_T11;Liver;Lung;Parietal;Liver_N6;H1;Liver_N13;Kidney;Hs68;Liver_T21;Liver_N20;Liver_N22;Liver_N17;Liver_T18;Liver_N21;Liver_T20;Liver_N18;Liver_N19 | ||||||||
| Method for Estimation | Ribo-;poly(A)-;RNaseR | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circRNA_100219 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr1:51121113-51210447:- | ||||
| CircRNA type | exonic | Gene ID | ENSG00000203356.2 | ||||
| Gene Name | LINC01562 | Detection pipeline | n/a | ||||
| Sample Type | Esophageal cancer | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circ_100219/hsa_circ_0004619 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr1:51121113-51210447:- | ||||
| CircRNA type | N/A | Gene ID | ENSG00000203356.2 | ||||
| Gene Name | LINC01562 | Detection pipeline | N/A | ||||
| Sample Type | breast cancer | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | TGCTACAGACGACTCAGAGA | ||||||||
| Reverse Primer | AGATGATGAAGGTGGTGGCA | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |