Aliases hsa_circ_0005567 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr1:51868106-51874004:-
CircRNA type . Gene ID ENSG00000078618.21
Gene Name NRDC Detection pipeline .
Sample Type Hs68_RNase; Hs68_control; Nhek; K562; Hepg2; H1hesc; Gm12878; Bj; Ag04450; A549; Sknshra
Method for Estimation RNA-Seq with Rnase R resistance
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25234927
Aliases HSA_CIRCpedia_32260 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr1:51868106-51874004
CircRNA type . Gene ID NA
Gene Name NA Detection pipeline .
Sample Type Cortex;Liver_N14;Liver;Liver_T10;Liver_N7;Cerebellum;PA1;AG04450;NHEK;Liver_T7;SH-SY5Y_D0_exp1;Temporal;Heart;H1;Liver_T14;Liver_T13;Occipital;SH-SY5Y_D0_exp2;Liver_N11;Stomach;Lung;SH-SY5Y_D4_exp1;Liver_N3;Liver_T6;SH-SY5Y_D8_exp2;Diencephalon;BJ;Liver_T15;Liver_N10;Forebrain;Liver_N12;SH-SY5Y_D2_exp1;Kidney;Liver_N8;Liver_T11;Parietal;Liver_T8;Liver_T3;H9;A549;Liver_N6;Liver_N13;Liver_T12;K562;HepG2;GM12878;Liver_N15;Thyroid;Hs68;Liver_T21;Liver_T19;Liver_N22;Liver_T22;Liver_T17;Liver_N20;Liver_T20;Liver_N21;Liver_N17;Liver_N18;Liver_N19
Method for Estimation Ribo-;poly(A)-;RNaseR
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 30172046
Aliases circ_005876 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr1:51868106-51874004:-
CircRNA type n/a Gene ID ENSG00000078618.21
Gene Name NRDC Detection pipeline Find_circ
Sample Type colorectal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 25624062
Aliases hsa_circRNA_100226 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr1:51868106-51874004:-
CircRNA type exonic Gene ID ENSG00000078618.21
Gene Name NRDC Detection pipeline n/a
Sample Type Esophageal cancer
Method for Estimation .
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer .
Reverse Primer .
Pubmed 27465405
Aliases circRNA-MSR/hsa_circ_0005567 Scientific name Homo sapiens (hg19)
Organism Human Genome Locus chr1:51868106-51874004:-
CircRNA type N/A Gene ID ENSG00000078618.21
Gene Name NRDC Detection pipeline N/A
Sample Type Osteoarthritis
Method for Estimation Microarray and Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer CCTCTCTCTAATCAGCCCTCTG
Reverse Primer GAGGACCTGGGAGTAGATGAG
Pubmed 28624198
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size