| Aliases | hsa_circ_0034398 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr15:36936478-36950106:+ | ||||
| CircRNA type | . | Gene ID | ENSG00000134138.19 | ||||
| Gene Name | MEIS2 | Detection pipeline | . | ||||
| Sample Type | K562; Huvec; Hepg2; Helas3; H1hesc; Gm12878; Bj; Ag04450; Sknshra; Mcf7 | ||||||||
| Method for Estimation | RNA-Seq with Rnase R resistance | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | HSA_CIRCpedia_14016 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr15:36936478-36950106 | ||||
| CircRNA type | . | Gene ID | NA | ||||
| Gene Name | NA | Detection pipeline | . | ||||
| Sample Type | Heart;AG04450;Diencephalon;Liver;H9;Liver_T14;H1;Occipital;Liver_T12;Cerebellum;A549;K562;PA1;Temporal;Cortex;SH-SY5Y_D2_exp1;Stomach;BJ;Kidney;Parietal;GM12878;SH-SY5Y_D4_exp1;Hs68 | ||||||||
| Method for Estimation | Ribo-;poly(A)-;RNaseR | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circRNA_101471 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr15:36936478-36950106:+ | ||||
| CircRNA type | exonic | Gene ID | ENSG00000134138.19 | ||||
| Gene Name | MEIS2 | Detection pipeline | n/a | ||||
| Sample Type | Esophageal cancer | ||||||||
| Method for Estimation | . | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | . | ||||||||
| Reverse Primer | . | ||||||||
| Aliases | hsa_circ_101471/hsa_circ_0034398 | Scientific name | Homo sapiens (hg19) | ||||
| Organism | Human | Genome Locus | chr15:36936478-36950106:+ | ||||
| CircRNA type | N/A | Gene ID | ENSG00000134138.19 | ||||
| Gene Name | MEIS2 | Detection pipeline | N/A | ||||
| Sample Type | Systemic Lupus Erythematosus | ||||||||
| Method for Estimation | Microarray and Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | TCTACAGGAACACGAGGAAACT | ||||||||
| Reverse Primer | CTGGTACTCCTGGGAGAAGAT | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |