| Aliases | HVU_circ00990 | Scientific name | Hordeum vulgare | ||||
| Organism | Barley | Genome Locus | Chr3:486789367-486789848:- | ||||
| CircRNA type | exonic | Gene ID | MLOC_54960 | ||||
| Gene Name | n/a | Detection pipeline | find_circ;CIRI2;Finder | ||||
| Sample Type | n/a | ||||||||
| Method for Estimation | n/a | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | n/a | ||||||||
| Reverse Primer | n/a | ||||||||
| Pubmed | PMC5727401 | ||||||
| Aliases | HVU_circ00990 | Scientific name | Hordeum vulgare | ||||
| Organism | Barley | Genome Locus | Ch3:486789367-486789848/MLOC_54960 | ||||
| CircRNA type | exonic | Gene ID | n/a | ||||
| Gene Name | MLOC_54960 | Detection pipeline | CIRI | ||||
| Sample Type | Various Cellular Metabolism | ||||||||
| Method for Estimation | Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | CCTCACCTACCGATCCGCAT | ||||||||
| Reverse Primer | CCACATCGCGTGCATGATCT | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |