Aliases HVU_circ03016 Scientific name Hordeum vulgare
Organism Barley Genome Locus Chr3:351423944-351425007:+
CircRNA type other Gene ID n/a
Gene Name n/a Detection pipeline CIRI2
Sample Type n/a
Method for Estimation n/a
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer n/a
Reverse Primer n/a
Aliases HVU_circ03016 Scientific name Hordeum vulgare
Organism Barley Genome Locus Ch3:351423944-351425007/MLOC_56360
CircRNA type N/A Gene ID n/a
Gene Name n/a Detection pipeline CIRI
Sample Type Various Cellular Metabolism
Method for Estimation Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer CAAATGTAATATTGTTTCTTGGGGCAT
Reverse Primer TGAGATCCTGCTCCAGAAATACTTTGA
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size