| Aliases | Cox1_circular RNA3 | Scientific name | Hordeum vulgare | ||||
| Organism | Barley | Genome Locus | Ch1:23864318-238668057/MLOC_372 | ||||
| CircRNA type | N/A | Gene ID | n/a | ||||
| Gene Name | n/a | Detection pipeline | CIRI | ||||
| Sample Type | Various Cellular Metabolism | ||||||||
| Method for Estimation | Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | AAGCAGTGGAAAGAACAAAAAATGT | ||||||||
| Reverse Primer | CTTCCCACCGGATCCTCTGTT | ||||||||