| Aliases | mmu_circ_014269 | Scientific name | Macaca mulatta | ||||
| Organism | Monkey | Genome Locus | chr4_95400562_95404880_R | ||||
| CircRNA type | circRNA | Gene ID | n/a | ||||
| Gene Name | N/A | Detection pipeline | N/A | ||||
| Sample Type | Muscle | ||||||||
| Method for Estimation | Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | CCTAGAGCTGCCAAGAAGCA | ||||||||
| Reverse Primer | TTTTCTAGTTTCATCATCAGCAGTTT | ||||||||