| Aliases | circ-1993 | Scientific name | Ovis aries | ||||
| Organism | Sheep | Genome Locus | chr16:70933022-70967025:- | ||||
| CircRNA type | intron | Gene ID | n/a | ||||
| Gene Name | ENSOARG00000016113 | Detection pipeline | n/a | ||||
| Sample Type | Pitutary gland | ||||||||
| Method for Estimation | Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | ACCCTGGTAGTCAGAAGCGAT | ||||||||
| Reverse Primer | TATCCCATAGAGTTTCATCAGGTC | ||||||||