| Aliases | Os03circ25430 | Scientific name | Oryza sativa | ||||
| Organism | Rice | Genome Locus | chr03:30817431-30817816:+ | ||||
| CircRNA type | cds-cds | Gene ID | n/a | ||||
| Gene Name | Os03t0732100-01 | Detection pipeline | n/a | ||||
| Sample Type | Panicles and mature leaves | ||||||||
| Method for Estimation | Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | CCACCACATGGGGATCAT | ||||||||
| Reverse Primer | AGTCGAAGAAGTTCACCACCAT | ||||||||