| Aliases | Os05circ14065 | Scientific name | Oryza sativa | ||||
| Organism | Rice | Genome Locus | chr05:24293818-24294550:- | ||||
| CircRNA type | cds-3utr | Gene ID | n/a | ||||
| Gene Name | Os05t0492500-01 | Detection pipeline | n/a | ||||
| Sample Type | Panicles and mature leaves | ||||||||
| Method for Estimation | Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | TATGAGATGGATGACCTGCTTG | ||||||||
| Reverse Primer | AAGTGACGAGTCAAGTCTGCAA | ||||||||