| Aliases | CircRNA228 | Scientific name | Poncirus trifoliata | ||||
| Organism | Citrus | Genome Locus | n/a | ||||
| CircRNA type | n/a | Gene ID | n/a | ||||
| Gene Name | n/a | Detection pipeline | CIRI | ||||
| Sample Type | terminal bud and the five following buds | ||||||||
| Method for Estimation | Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | ATGCTGGACAGATGGAAAGAG | ||||||||
| Reverse Primer | GGGCGATTGAAACTTTGAGC | ||||||||