| Aliases | rno_circRNA_010886 | Scientific name | Rattus rattus | ||||
| Organism | Rat | Genome Locus | chr3:58829806-58830430:- | ||||
| CircRNA type | sense | Gene ID | n/a | ||||
| Gene Name | NM_001015032 | Detection pipeline | Microarray | ||||
| Sample Type | Kidney | ||||||||
| Method for Estimation | n/a | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | n/a | ||||||||
| Reverse Primer | n/a | ||||||||
| Aliases | rno_circRNA_010886 | Scientific name | Rattus rattus | ||||
| Organism | Rat | Genome Locus | chr3:58829806-58830430:- | ||||
| CircRNA type | sense | Gene ID | n/a | ||||
| Gene Name | NM_001015032 | Detection pipeline | n/a | ||||
| Sample Type | Kidney | ||||||||
| Method for Estimation | Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | ACCACCCGAGTCTTACCATTT | ||||||||
| Reverse Primer | TTGTGACTTGACAGATGACGGTT | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |