| Aliases | ssc_circ:chr7:21868824-21869232 | Scientific name | Sus scrofa | ||||
| Organism | Pig | Genome Locus | chr7:21868824-21869232:n/a | ||||
| CircRNA type | exonic | Gene ID | n/a | ||||
| Gene Name | OATV1 | Detection pipeline | n/a | ||||
| Sample Type | liver | ||||||||
| Method for Estimation | Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | GCTACTGGTGGGATGAGCAG | ||||||||
| Reverse Primer | TGGAACAAGGCCGACTTACC | ||||||||