| Aliases | chr11:40159197-40151022 | Scientific name | Solanum tuberosum | ||||
| Organism | Potato | Genome Locus | chr11:40151022-40159197:- | ||||
| CircRNA type | exon | Gene ID | n/a | ||||
| Gene Name | PGSC0003DMG402007403 | Detection pipeline | CIRI | ||||
| Sample Type | Stem tissues subjected to Brasiliense Infection | ||||||||
| Method for Estimation | Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | TTTCGTGCAGCGTCTCATCA | ||||||||
| Reverse Primer | ATCATTCTTCACCTGATCTAGGGC | ||||||||