| Aliases | NW_016694872.1:550852-632532- | Scientific name | Xenopus laevis | ||||
| Organism | African clawed frog | Genome Locus | NC_030725.1:146024662-146027824+ | ||||
| CircRNA type | n/a | Gene ID | n/a | ||||
| Gene Name | n/a | Detection pipeline | n/a | ||||
| Sample Type | Testis of tadpoles | ||||||||
| Method for Estimation | n/a | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | n/a | ||||||||
| Reverse Primer | n/a | ||||||||
| Aliases | NW_016694872.1:550852-632532- | Scientific name | Xenopus laevis | ||||
| Organism | African clawed frog | Genome Locus | NW_016694872.1:550852-632532- | ||||
| CircRNA type | N/A | Gene ID | N/A | ||||
| Gene Name | N/A | Detection pipeline | N/A | ||||
| Sample Type | Testis of tadpoles | ||||||||
| Method for Estimation | Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | CTTCTGTGGTCACCGGAAGT | ||||||||
| Reverse Primer | TGGACATGTGAACTGGGTGT | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |