| Aliases | NC_030734.1:106398702–106449286+ | Scientific name | Xenopus laevis | ||||
| Organism | African clawed frog | Genome Locus | NC_030734.1:106398702–106449286+ | ||||
| CircRNA type | N/A | Gene ID | N/A | ||||
| Gene Name | N/A | Detection pipeline | N/A | ||||
| Sample Type | Testis of tadpoles | ||||||||
| Method for Estimation | Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | CCTGTTGCTTAGGCCATCAT | ||||||||
| Reverse Primer | TGTGATGAGGCAGAGTTTCG | ||||||||