Aliases circ1493 Scientific name Zea mays
Organism Maize Genome Locus chr10:89163060-89165558:+
CircRNA type n/a Gene ID n/a
Gene Name GRMZM2G060987 Detection pipeline KNIFE
Sample Type third leaves of B73 V3 stage seedlings
Method for Estimation n/a
Circular RNA status Experimented PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer n/a
Reverse Primer n/a
Aliases circ1493 Scientific name Zea mays
Organism Maize Genome Locus chr10:89163060-89165558:+
CircRNA type n/a Gene ID n/a
Gene Name GRMZM2G060987 Detection pipeline KNIFE
Sample Type third leaves of B73 V3 stage seedlings
Method for Estimation Quantitative PCR
Circular RNA status Validated PCR Details Link to the detailed experimental procedure
Primers (Experimented)
Primers (Validated)
Forward Primer GAACACAACAAAAAGAGTTACAAGA
Reverse Primer GGCTATAGCTTCACCAGGAACTAT
Suggested primers
Product size Left primer Right primer Left GC Right GC Left TM Right TM Left pos Right pos Left size Right size
145 GACAGTGTCCGGTGGTGC CAACTCGCCAATCATCGACA 66.667 50 60.665 58.641 153 297 18 20
170 CTCCAAGCCTGCCAACGG TTCTGCGTCATTACCCTGCT 66.667 50 61.058 59.387 100 269 18 20
194 CTGCCAACGGTCGGCTTC AGTTCAACTCGCCAATCATCG 66.667 47.619 61.423 58.997 108 301 18 21
171 TCGCCAAATAAAGAAGGAAATCC CTCGCCAATCATCGACATCTC 39.13 52.381 57.424 58.943 124 294 23 21
232 CAAGCCTGCCAACGGTCG CCTTGAGTTGCTTCACTTGGAA 66.667 45.455 61.727 59.048 103 334 18 22