| Aliases | circ2773 | Scientific name | Zea mays | ||||
| Organism | Maize | Genome Locus | chr8:144498325-144498714:- | ||||
| CircRNA type | n/a | Gene ID | n/a | ||||
| Gene Name | GRMZM2G024738 | Detection pipeline | KNIFE | ||||
| Sample Type | third leaves of B73 V3 stage seedlings | ||||||||
| Method for Estimation | n/a | ||||||||
| Circular RNA status | Experimented | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | n/a | ||||||||
| Reverse Primer | n/a | ||||||||
| Aliases | circ2773 | Scientific name | Zea mays | ||||
| Organism | Maize | Genome Locus | chr8:144498325-144498714:- | ||||
| CircRNA type | n/a | Gene ID | n/a | ||||
| Gene Name | GRMZM2G024738 | Detection pipeline | KNIFE | ||||
| Sample Type | third leaves of B73 V3 stage seedlings | ||||||||
| Method for Estimation | Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | GGTACTCCGCCATGTACCG | ||||||||
| Reverse Primer | AATCGCCAGTACGGTCCAAA | ||||||||
| Suggested primers | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Product size | Left primer | Right primer | Left GC | Right GC | Left TM | Right TM | Left pos | Right pos | Left size | Right size | |