| Aliases | circ_13 | Scientific name | Zea mays | ||||
| Organism | Maize | Genome Locus | chr10_GRMZM2G143356:145379334_GRMZM2G086030:144619364 | ||||
| CircRNA type | n/a | Gene ID | n/a | ||||
| Gene Name | n/a | Detection pipeline | KNIFE | ||||
| Sample Type | third leaves of B73 V3 stage seedlings | ||||||||
| Method for Estimation | Quantitative PCR | ||||||||
| Circular RNA status | Validated | PCR Details | Link to the detailed experimental procedure | ||||||
| Primers (Experimented) | |||||||||
| Primers (Validated) | |||||||||
| Forward Primer | GTTGGTTATGGGCTGTGCTT | ||||||||
| Reverse Primer | TTGCATACAGGAACAATGCTG | ||||||||