| Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
| CircSMARCA5 | |||
| Gene | Organism | Human | |
| Genome Locus | Build | hg19 | |
| Disease | Glioblastoma | ICD-10 | Malignant neoplasm of Brain, unspecified (C71.9) |
| DBLink | Link to database | PMID | 29415469 |
| Experimental Method | |||
| Sample Type | Tissue and cell lines | Comparison | GBM biopsies from five fresh-frozen (training set) and fifty-six FFPE (test set) sample with adjacent normal tissue |
| Method for Estimation | Quantitative PCR | PCR Details | |
| Primers (Experimented) | Forward ACAATGGATACAGAGTCAAGTGTT ReverseCCACAAGCCTCCCTTTTGTTTT | Statistics | Fold Change : Downregulated pvalue : p<0.0001 |
| Citation | |||
| Barbagallo, D, Caponnetto, A, Cirnigliaro, M, Brex, D, Barbagallo, C, D'Angeli, F, Morrone, A, Caltabiano, R, Barbagallo, GM, Ragusa, M, Di Pietro, C, Hansen, TB, Purrello, M (2018). CircSMARCA5 Inhibits Migration of Glioblastoma Multiforme Cells by Regulating a Molecular Axis Involving Splicing Factors SRSF1/SRSF3/PTB. Int J Mol Sci, 19, 2:no page given. | |||